MICoA, a Novel MTA 1 Interacting Protein Coactivator, Regulates Estrogen Receptor-alpha Transactivation Functions*

The transcriptional activity of estrogen receptor-alpha (ER) is modified by coactivators, corepressors and chromatin remodeling complexes. We have previously shown that the metastasis-associated protein-1 (MTA1), a component of histone deacetylase and nucleosome remodeling complexes, represses ER-driven transcription by recruiting histone deacetylases (HDACs) to the estrogen receptor element (ERE)-containing target gene chromatin in breast cancer cells. Using a yeast two-hybrid screening to clone MTA1-interacting proteins, we identified a previously uncharacterized molecule, which we named as MTA1-interacting coactivator (MICoA). Our findings suggest that estrogen signaling promotes nuclear translocation of MICoA and that MICoA interacts with MTA1 both in vitro and in vivo. MICoA binds to the C-terminal region of MTA1, while MTA1 binds to the N-terminal MICoA containing one nuclear receptor interaction LSRLL motif. We showed that MICoA is an ER coactivator, cooperates with other ER coactivators, stimulates ER-transactivation functions, and associates with the endogenous ER and its target gene promoter-chromatin. MTA1 also repressed MICoA-mediated stimulation of ERE mediated transcription in the presence of ER and ER variants with the naturally occurring mutations such as D351Y and K302R, and that it interfered with the MICoA’s association with the ER-target gene chromatin. Since chromatin is a highly dynamic structure and because MTA1 and MICoA could be detected within the same complex, these findings suggest that MTA1 and MICoA might transmodulate functions of each other and any potential deregulation of MTA1 is likely to contribute to the functional inactivation of ER pathway, presumably by derecruitment of MICoA from ER target promoter chromatin. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from Introduction The steroid hormone 17 beta-estradiol (E2) plays an important role in controlling the expression of genes involved in a wide variety of biological processes, including reproduction, development, and breast tumor progression (1-3). The biological effects of estrogen are mediated by its binding to the structurally and functionally distinct estrogen receptors (ERand ER). ERis the major estrogen receptor in the mammary epithelium. Like other steroid nuclear receptors, ERcomprises of an N-terminal transcriptional activation function (AF1) domain, a DNA-binding domain, and a C-terminal ligand-binding domain (LBD) that contains a liganddependent transcriptional activation function 2 (AF2) domain (4). Binding of hormone to ER triggers conformational changes that allow ER to bind the responsive elements in the target gene promoters. The ligand-activated ERthen translocates to the nucleus, binds to the 13-base-pair palindromic estrogen response element (ERE) in the target gene promoters, and stimulates gene transcription, thereby promoting the growth of breast cancer cells. In addition, a series of recent studies also demonstrate other actions of the estrogen receptors, which involve protein-protein interactions (i.e. with AP-1 and SP-1) rather than direct DNA binding. As with hormonal regulation, the transcriptional activity of ER is affected by a number of regulatory cofactors including chromatin-remodeling complexes, coactivators, and corepressors (5 –9). Coactivators generally do not bind to the DNA but are recruited to the target gene promoters through protein-protein interactions with the ER. Examples of ER coactivators include, members of the p160 family, SRC1-3, AIBI, TRAM1, RAC3, CREB binding protein CBP and p300 (10-11). Corepressors preferentially associate with antagonist occupied ER (1214). Among the ER corepressors, NCoR and SMRT are widely characterized molecules, that have been implicated in the transcriptional silencing that happens in the absence of ligands (15). by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from In addition, a few bifunctional coregulators such as PELP1 also exist that can act both as coactivators and corepressors of ER (16) Evidence suggests that multi-protein complexes containing coactivators, ERs and transcriptional regulators assemble in response to hormone binding and that they activate transcription. The molecular mechanisms of ER, the composition of the ER coactivator proteins and the way these hormones illicit tissue or cell-type specific responses are active areas of investigation. A structural analysis of the ER coactivators has identified a five-amino acid NR motif LXXLL (where X is any amino acid) that can mediate coregulator binding to the liganded ERs (17-19). For transcription factors to access DNA, the repressive chromatin structure must be remodeled. Dynamic alterations in the chromatin structure resulting from the acetylation of histones can facilitate or suppress the access of the transcription factors to nucleosomal DNA, leading to transcriptional regulation (20-22). Hyperacetylated chromatin is generally associated with transcriptional activation, whereas hypoacetylated chromatin is associated with transcriptional repression (23-28). Transcriptional outcome is regulated by a dynamic interaction of histone acetyltransferases (HATs) and histone deacetylases (HDACs). Coactivators like SRC1-3, CBP/p300 have been shown to possess intrinsic histone acetyltransferase activity (HAT) (4,29-32) while corepressors such as NCoR and metastasis associated 1 (MTA1) protein are associated with HDACs (33-35). The MTA1 gene was originally identified by differential expression in rat mammary adenocarcinoma metastatic cells and is now known to correlate well with the metastatic potential of several human cell lines and tissues (14,35-37). MTA1 has also been shown to physically interact with HDAC and repress the estrogen receptor alpha-driven transcription by recruiting HDAC to the ERE-containing target gene chromatin in breast cancer by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from cells (35) Although MTA1 is known to be a part of the HDAC complex, the nature of its target or targets remains unidentified. To better understand the cellular functions of MTA1 in breast cancer cells, we performed a yeast two-hybrid screen to clone MTA1-interacting proteins, and identified a previously uncharacterized protein (Genebank accession number S 82447), which we named as MTA1interacting coactivator (MICoA). Here, we show that MICoA is a bona-fide coactivator of ER transactivation functions and that its interaction with MTA1 controls the dynamics of ER-driven transactivation by influencing its association with ER-target gene promoter chromatin. Materials and Methods Plasmid Construction and Two-hybrid Library Screening. The full length MTA1 (1 – 715 aa) was digested at BamHI and XbaI (blunt end) and ligated to the pGBKT7 vector that expresses proteins fused to amino acids 1-147 of the GAL4-DNA binding domain (DNA-BD) at BamHI and PstI (blunt end) (Clontech). MTA1 baits were constructed by deleting 1-254 amino acids from the N-terminal of MTA1 by cutting and self-ligating with Nco1 that cleave first 254 amino acids. The remaining 255-715 amino acids of the C-terminal MTA1 (CT-MTA1) were used as bait. This bait was used to screen a mammary gland cDNA library fused to Gal4 activation domain (Clontech) was screened according to manufacturer's instructions. Positive clones were also verified by one-on-one transformations and selection on agar plates lacking leucine and tryptophan (LT) or adenine, histidine, leucine and tryptophan (AHLT) and also processed for by -galactosidase ( -gal) assay. Full length MICoA was either cloned into pCDNA 3.1A or pGEX 5X-1 vectors at Eco R1 and Xho 1 sites. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from Cell Cultures and Reagents. Human breast cancer cells were cultured in the DMEM/F12 medium supplemented with 10% fetal bovine serum. For estrogen treatment experiments, regular medium was replaced by medium containing 3% DCC (charcoal-stripped serum). Antibodies against c-myc tag were from MBL International, Watertown, MA. Anti-ER was from Upstate Biotechnology, USA, whereas anti-mouseand anti-rabbit-horseradish peroxidase-conjugate were from Amersham, Piscataway, NJ. In-situ Hybridization. For in-situ hybridization, mouse mammary gland tissues or 13.5 day old embryos were cut out and fixed with 4% paraformaldehyde and frozen sections were cut (35). In situ hybridization was done by using the digoxigenin (Roche) labeled riboprobe. A 375 bp of mouse MICoA cDNA was amplified by RT-PCR, subcloned into TOPO II vector (Promega) and used for riboprobe synthesis under the control of T7 promoter. Primers used are, FCCAGCCCGGAATTCCCATGC-TGTCCCGCCTC; RGGAGGGAACTCGAGCTAGGAAGGGGCAGAC; RNA probes were labeled with digoxigenin and hybridized for 16-20 h in buffer containing 1 g/ml riboprobes, 50% formamide, 300 mM NaCl, 10 mM Tris (pH 7.4), 10 mM NaH2PO4 (pH 6.8), 5 mM EDTA (pH 8.0), 0.2% Ficoll 400, 0.2% polyvinyl pyrolidone, 10% dextran sulfate, 200 ug/ml yeast total RNA, and 50 mM dithiothreitol. Alkaline phosphatase labeled sheep anti-digoxigenin antibody was applied and signals were visualized by NBT-BCIP. Hybridization with sense-probe was used as background control. Chromatin Immunoprecipitation (ChIP) Assay. Approximately 10 cells were treated with 1% formaldehyde (final concentration, v/v) for 10 min at 37 C to cross-link histones to DNA. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from ChIP assay was performed as described (35). The sequence of the forward and reverse primers for pS2 used in this study is GAATTAGCTTAGGCCTAGACGGAATG and AGGATTTGCTGATAGACAGAGACGAC respectively. Histone Acetyl-transferase (HAT) Assay. Cells were either treated with/ without estrogen (10M). Then cells were lysed and immunoprecipitated with anti T7 antibody. Immunoprecipitate was taken for histone acetyl transferase assay by HAT-Check (Histone acetyl transferase) activity assay kit (Pierce, IL). HAT assay with positive control in each assay was performed as per the instruction with little modifications (5). Immunofluorescence and Confocal Imaging. MCF7 cells were plated on glass cover slips in 6-well culture plates. When the cells were approximately 50% confluent, they were changed to DCC medium supplemented with 5% fetal calf serum for 48 hours, then treated with estrogen (10 9 M) for 30 min with or without pretreatment with the anti-estrogen ICI (10 M) for 1 h. Cells were rinsed with PBS, fixed in cold methanol for 6 min, then processed for immunofluorescence staining of c-myc-tagged MTA1 or estrogen receptor. Cells were counter-stained with ToPro3 to visualize the nucleus. Slides were further processed for imaging and confocal analysis using a Zeiss LSM 510 microscope and a 40X objective. Transfection and Promoter Assays. Cells were maintained in DMEM/ F12 (1:1) supplemented with 10% fetal calf serum. For reporter-gene transient transfections, cells were cultured in medium without phenol red and containing 3% Charcoal-stripped (DCC) serum for 24by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from 36 h, and promoter assays and in vitro transcription and translation and GST pull-down assays were performed as previously described (35). Results Identification of MICoA as MTA1 interacting Protein. MTA1 is expressed in a wide range of tissues, yet the nature of its downstream targets remains unknown. To identify novel MTA1-interacting proteins, we performed a yeast two-hybrid screening of the mammary gland cDNA expression library using the MTA1 C-terminal amino acids 255-715 and MTA1 Nterminal amino acids 1-254 as the baits. As a negative control, we used recently identified MTA1s variant that lacks protein-binding motifs (38) as a bait. Yeast cells expressing the Gal4 fusion protein were transformed with the above bait. Screening of 2X 10 transformants resulted in the isolation of several positive clones. Sequencing of the positive clones identified several clones that encoded the full-length cDNA of a previously uncharacterized gene assigned to chromosome 12q13-q14 (Genebank accession number S82447). To further confirm MICoA’s interaction with MTA1, we cotransfected C-terminal or N-terminal MTA1 constructs with MICoA and the transformed colonies showed both the ability to grow in medium lacking adenosine, histidine, tryptophan, and leucine (AHTL) and to turn blue in a -galactosidase assay, while cotransfection with the control GBK vector did not do so (Fig. 1A). Since we discovered a coactivator function of this gene product (see below), we named this protein as MTA1 interacting coactivator (MICoA). MICoA contains a total of 378 base pairs and encodes a protein of 125 amino acids (about 14 kDa) and has an overall 23.5% scattered homology with yeast GCN5. Sequence analysis of MICoA revealed the presence of a consensus by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from nuclear receptor binding site (NR box, LXXLL) in the N-terminal region and a casein kinase phosphorylation site (TALE) in the C-terminal segment (Fig. 1B). MICoA mRNA was easily detectable in ER-positive breast cancer cell lines, such as MCF-7, ZR-75R and T47D but modest expression levels could also be detected in other cell lines (Fig. 1C). Full length MICoA has been cloned into pCDNA3.1A and pGEX 5X-1 vectors. Their expression has been shown in figure 1D. MICoA Expression During Development. To gain clues about the possible functions of MICoA in vivo, we examined the expression of MICoA mRNA in multiple mouse tissues. As shown in Fig. 2A, MICoA mRNA could be easily detected in many mouse tissues, with the highest level in the mammary glands of pregnant mice. To get a deeper view, we further performed in situ hybridization to determine the levels of MICoA expression during embryonic development and in the mammary glands. At the 13.5 day mouse embryo, MICoA was widely expressed in various of tissues (Fig. 2B). In mouse mammary glands, MICoA expression was seen in ductal epithelial cells as well as in fat cells, while the expression became much stronger in the alveolar cells during pregnancy (Fig. 2C). MICoA Interacts with MTA1 in vitro and in vivo. To confirm the interaction between MICoA and MTA1, we next examined the ability of in vitro-translated MICoA protein to bind with glutathione-S-transferase (GST)-MTA1 in-vitro. MICoA1 interacted efficiently with GSTMTA1 but not with GST alone in GST pull-down assays (Fig. 3A). To demonstrate the interaction of MICoA and MTA1 in breast cancer cells, the ZR-75R breast cancer cells were cotransfected with T7-tagged MICoA or c-myc-tagged MTA1 or a pCMV control vector. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from Immunoprecipitation of cell lysates with an anti-T7 monoclonal antibody was followed by immunoblotting with the anti-c-myc antibody. Results showed a specific baseline as well as an estrogen (E2)-inducible interaction between the T7-MICoA and c-myc-MTA1 (Fig. 3B). We explored the spatial relationship between MICoA and MTA1 within cells using immunofluorescence and confocal scanning microscopy. ZR-75 cells were transiently transfected with T7-MICoA and Myc-MTA1. The cells were grown in phenol-red-free medium supplemented with 3% charcoal-stripped serum, treated with E2 (10 M) for 30 min, and then fixed in methanol and stained for c-myc-tag (green) and T7-tag (red), and counter stained for nuclear DNA (blue). As shown in Fig. 2C, T7-MICoA was localized predominantly in the cytoplasm, but upon E2 stimulation it was redistributed to the nucleus suggesting that this effect is mediated by the ER, and could be blocked by anti-estrogen ICI 182780 (data not shown). Areas of colocalization of the T7-MICoA and c-myc-MTA1 proteins resulted in the development of yellow fluorescence because of the merging of the red and green pixels (Fig. 3C). Transfected MTA1 was primarily localized in the nucleus. These findings suggest that E2-signaling promotes the nuclear translocation of MICoA. MICoA Interacts with the C-terminal Region of MTA1. Next, we defined the minimal region of MTA1 required for its interaction with MICoA1. MTA1 has several important domains involved in protein-protein interactions, DNA binding, and signaling (Fig. 4A). Several Cterminal MTA1 deletion constructs were generated and expressed as S-labeled proteins; they were then subjected to GST pull-down assays with the GST-MICoA fusion protein. Results suggest that amino acids 441-703 of MTA1, which contains one SH3 and one SH2 site, constituted the binding region for MICoA (Fig. 4B, left panels). To define the binding region or by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from regions of MICoA that are important for MTA1 interaction, we disrupted the NR box by deleting the LSRLL motif (MICoA-del-1). In addition, we also deleted the CK2 phosphorylation consensus site (MICoA-del-2) or both the NR both and CK2 phosphorylation site (MICoA-del-3) (Fig. 4C). Results of the GST-pull down assays indicate that MICoA used its LSRLL motif to interact with MTA1 (Fig. 4D). This further demonstrated that the N-terminal region of MICoA interacts with the C-terminal region of MTA1. MICoA Acts As a Coactivator of ER. The presence of an LSRLL motif and the abundant expression of MICoA in the mammary glands of pregnant mice raised the possibility of MICoA’s role in the ER pathway. To explore this notion, we examined the potential ability of MICoA to influence the transcription from an ERE-luciferase reporter system, using either ERpositiveZR75 or MCF-7/LTED cells or ER-negative HeLa cells co-transfected with the ER. Coexpression of MICoA resulted in more stimulation of ERE-driven transcription in the cells treated with E2 treatment than in the mock-treated cells (Fig. 5A). The expression of MICoA alone in hypersensitive MCF-7/LTED cells (39) had a modest but reproducible stimulatory effect on reporter activity in the absence of ligands. This MICoA-mediated increase in the EREluciferase activity was dose-dependent, with the highest activity at 500 ng of DNA (Fig. 5B). As with other well-characterized coactivators (Fig. 5C), cotransfection of Hela cells with PELP1 and T7-MICoA but not vector control significantly increased ERE-luc reporter activity by PELP1, a recently identified ER coactivator. Since LXXLL motif is also important for binding to other nuclear receptors we tried to explore the effect of MICoA on progesterone receptor (PR) as well as glucocorticoid receptor (GR) by using PRE-luc and GRE-CAT (Fig. 5D and E). MICoA could induce PR transactivation whereas GR transactivation remains unaltered. Together, these by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from findings suggest that MICoA is a coactivator of ER pathway and selective in its transactivation function. MICoA Associates with the ERE-responsive Promoters in Vivo. To directly demonstrate the potential importance of MICoA in ERE-transcription, we used the chromatin immunoprecipitation (ChIP) assay to analyze whether T7-MICoA associates with the endogenous ERE-containing promoters. MCF-7 cells transfected with T7-MICoA, were treated with E2 for different lengths of time and processed to formaldehyde cross-link and to sonicated chromatin for immunoprecipitation with specific antibodies against T7. T7-MICoA-bound genomic DNA fragments were analyzed by quantitative PCR using primers spanning the ERE elements present in the promoter of the pS2 sequence, for a potential E2-triggered association of T7-MICoA with the promoter of the ER target gene. Results indicated that E2 treatment triggered a significant increase in the amount of pS2 (~12 fold more than for untreated cells) target gene promoter chromatin associated with T7-MICoA (Fig. 6A). Since MICoA promoted transcription from ERE containing promoter (Fig.5) and interacted effectively with the ER target gene chromatin (Fig. 6A), these findings raised the possibility that MICoA influences the status of chromatin remodeling, presumably through histone acetyl-transferase (HAT) activity. Therefore, we next explored the possibility of such activity associated with T7-MICoA complex. Immunoprecipitation of T7-MICoA from MCF-7 cells showed the presence of functional HAT activity with the MICoA (Fig. 6B). Since there is no HAT domain in the MICoA, the HAT activity we detected, is likely to come from the proteins that could associate with MICoA in vivo. In brief, these findings strongly support the notion that MICoA influences the status of the ER-target gene promoter using chromatin-remodeling mechanisms. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from MTA1 Represses MICoA’s Stimulation of transcription from ERE. Since MTA1 acts as a corepressor of the ER pathway (35) and since MICoA is both an ER coactivator and an MTA1interacting protein (as demonstrated in this study), we next investigated the potential impact of MTA1 deregulation on MICoA-mediated stimulation of ERE transcription. The ZR-75 breast cancer cells were co-transfected with ERE-luciferase, MICoA and MTA1 or with a control vector, and then stimulated with E2. Coexpression of MTA1 suppressed both MICoA-stimulated and E2-induced ERE-driven transcription (Fig. 7A). Similar results were obtained when we used the MCF-7 cells stably expressing T7-MTA1 (Fig. 7B). We explored the possibility of neutralisisng the ER corepressor MTA1 by MICoA using MCF-7 cells stably overexpressing PELP1 coactivator (40). As shown in fig. 6C, MICoA was a potent activator of ER transactivation in MCF-7/PELP1 cells. In addition, we also noticed that E2-treatement promoted interactions of T7-PELP1 with the endogenous MTA1 (Fig. 7C, insert). Furthermore, MTA1 overexpression also repressed the transcription normally stimulated by the coexpression of MICoA and PELP1 in MCF-7 cells (Fig. 7C, last two sets of columns). Since MTA1 and MICoA proteins have opposing effects on ERE transcription, our finding suggests that the MTA1 corepressor activity is dominant over MICoA’s coactivator function. Effect of MICoA on Transactivation Functions of ER with Naturally Occurring Mutations. In recent years, several naturally occurring mutations have been found in the ERs of breast cancer cells. One mutant ER, D351Y in the LBD was found in a tamoxifen-stimulated tumor line and enhances the estrogen-like actions of tamoxifen and raloxifene (12,41,42,44). Additionally, a mutant ER K303R at the boundry between the hinge region and the LBD of the by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from ERs (43). The mutant ER possesses an increased sensitivity to E2 Breast cancer cells with mutant ERs exhibit differential responsiveness to estrogen and anti-estrogen and this phenomenon may be associated with the potential differential recruitment of nuclear coregulators (42,44). To explore the role of coregulators in the actions of mutant ERs, we next determined the ability of MICoA, MTA1 or both to modulate the ER-transactivation function. As expected, expression of K302R ER in Hela cells resulted in hypersensitivity to the E2 response compared with expression of the wild-type ER (Fig. 8A). Interestingly, coexpression of MICoA was accompanied by a further enhancement of the E2 response compared with the levels of EREdriven transcription activated by the individual expression of K302R ER or MICoA. However, MTA1 overexpression effectively blocked the stimulation of ERE transcription by the mutant K302R ER in both the presence and the absence of MICoA (Fig. 8A). To examine the effect of MICoA on the mutant D351Y ER, we used well-characterized MDA-MB231 breast cancer cells stably expressing either wild-type ER (S30 cells) or D351R ER (BC cells) or D351G (JM cells) (45) As shown in Fig. 7B, MICoA stimulated ERE-transactivation to a comparable extent in S30 as well as BC, but not in JM cell lines and this stimulatory action was repressed by the overexpression of MTA1. In brief, these findings suggest that MICoA and MTA1 have potent influence on both ERs, naturally existing mutant ER, or mutant ER mimicking acetylated ER. The transactivation function is lost probably when it cannot bind to mutant ER (JM cells). MICoA Interacts with the ER . Since MICoA functions as a coactivator of ER, we next determined whether MICoA interacts with ER by using GST pull-down assays with the fulllength or deletion mutants of the ER. Results indicated that GST-MICoA but not GST alone bound to the C-terminal region (amino acids 301 to 552) containing the AF2 domain of the ER by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from as well as 264-300 representing the hinge region (Fig. 9A and B). Since MICoA interacts with the AF2 domain of the ER (Fig. 9A and B), we next tested the significance of this interaction by examining the recruitment of MICoA complexes to ER elements using a Gal4-ER/Gal4Luciferase assay system (46,47). This system involves transient transfection of two plasmids Gal4-AF2 (ligand-binding domain of ERand Gal4-luciferase reporter), and luciferase activation depends on E2 stimulation of the AF2 domain. In this assay the E2-mediated activation of the AF2 function was further stimulated by MICoA expression (Fig. 9C). Many coactivators have been shown to activate the transcription of specific promoters when recruited by a heterologous DNA-binding domain. In brief, these results suggested that MICoA-ER interaction might play a role in the coactivator function of MICoA. Coactivator Function of MICoA Requires LSRLL Motif. To explore the mechanism of MICoA regulation of ER transactivation, we investigated the significance of the nuclear receptor-binding motif in MICoA. As illustrated in Fig. 10A, MICoA with a mutated LSRLL motif was not able to stimulate ERE transcription in response to E2 treatment and exhibited much lower baseline ER transactivation activity. In addition, the MICoA without mutated NR box motif did not bind to the GST-AF2 as opposed to binding of wild type MICoA with GST AF2 (Fig. 10B). Since E2 stimulation triggered a rapid redistribution of T7-MICoA from the cytoplasm to the nucleus, we next determined the potential role of LSRLL in the nuclear translocation of MICoA. Interestingly, the MICoA with mutated LSRLL motif failed to translocate to the nucleus in E2-stimulated cells (Fig. 10C). Together, these results suggest that the LSRLL motif plays an important role in the movement of MICoA to the nucleus, binding of MICoA with estrogen receptor, and MICoA’s ER transactivation function. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from MTA1 Modifies MICoA’s Association with Target Chromatin. To understand the physiological significance of MICoA-MTA1 interaction in vivo, we determined whether MTA1 overexpression might influence the ability of MICoA to associate with promoter of the ER target gene promoter pS2. Breast cancer cells were cotransfected with T7-MICoA or T7-pcDNA and with the c-myc-MTA1 and stimulated with E2 for 30 min. T7-MICoA-bound genomic DNA fragments were analyzed by quantitative PCR using primers spanning the ER elements present in the promoter of the pS2 sequence. MICoA expression resulted in a significant association of the pS2 promoter chromatin with T7-MICoA (Fig. 11A, lane 4). Importantly, MTA1 coexpression reduced this association of T7-MICoA with the pS2 promoter chromatin (Fig. 11A, lane 6). Since MTA1 physically associates with HDAC2 (35), our findings suggest that MICoA interacts with the HDAC2 that is associated with MTA1. Indeed, the coimmunoprecipitation assays demonstrated the association of T7-MICoA with HDAC2 in the presence of c-myc-MTA1 and showed that E2 stimulation impaired the HDAC2 interaction with MICoA-MTA1 complex (Fig. 11B). There was no association of HDAC2 with T7-MICoA in the absence of c-myc-MTA1 (data not shown). Results from the Co-IP assays also show that T7-MICoA interacted effectively with the endogenous ERand that the MTA1 overexpression prevented such interactions (Fig. 11C, compare lane 4 with lane 2). Together, these results suggest that the coactivator functions of MICoA are closely linked with MICoA’s ability to interact with the ER and to recruit such a complex to the target gene promoter chromatin; they also suggest that MTA1 overexpression represses MICoA regulation of the ER pathway. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from Discussion The nuclear receptor (NR) super family of transcription factors regulates transcription activity upon the binding of specific steroid hormones (48-50). A conserved amphipathic alphahelical structure within the AF2 region of these factors is required for their ligand dependent transcriptional activation, whereas another region known as AF1 is responsible for their ligandindependent transactivating activity. It is increasingly accepted that NRs require a series of coregulators (i.e., coactivators and corepressors) for optimal transcription activity (51-55). Since several of these corepressors and coactivators have either intrinsic or associated HDAC and HAT activity, respectively, it has been proposed that transactivating functions of the ER, and of the NR in general are regulated by the combined action of coregulators and the stage of the chromatin-remodeling process. Since the target gene promoter chromatin is a highly dynamic structure, the transactivating functions of coactivators are likely to be influenced by corepressors and any potential deregulation of one component will have functional implications on the action of other components. However, to date this notion has not been validated for ER in breast cancer cells. In the current study we found out that a corepressor can co-exist with a co-activator and the functional manifestation is dependent upon the interplay of several other coregulators. This could be an important way of regulating ER transactivation in breast cancer cells. MICoA’s interaction with MTA1 has been mapped to the region of MTA1 having the binding sites for SH3 and SH2. There is a possibility that MICoA might be competing with the proteins possessing SH3 or SH2 domains. Interestingly, newly discovered variant of MTA1, the MTA1s showed no interaction with the MICoA, suggesting that MICoA is a specific binding protein for the MTA1. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from The results of our study show that the MICoA is an MTA1-interacting protein and that MICoA interacts with the endogenous ER, stimulates the ER-transactivation function, and associates with the ER target gene promoter chromatin, presumably by recruiting HATs. The MICoA is a novel ER coactivator with an overall 23% scattered homology with yeast GCN5L1 (56). As MICoA does not contain a HAT motif, the HAT activity is likely to come from its association with other interacting proteins. Structural and functional analyses of several coactivators revealed that coactivators interact with the ligand-bound AF2 domain through the LXXLL motif and are sufficient to mediate the binding of coactivators to ligand-bound NRs. A single LXXLL motif is enough to allow activation of ER by E2. MICoA is distinct from other coactivators in that it is localized primarily in the cytoplasm and is translocated to the nucleus upon E2 signaling. Furthermore, MICoA directly interacts with the AF2 domain of the ER and binding may be enhanced by E2 signaling. In addition, like other coactivators, MICoA exhibits an added stimulation of ER transactivation functions in the presence of other coactivator, such as PELP1 (Fig. 5C). The mechanism by which MICoA activates ERE transcription is not fully understood but appears to involve an absolute requirement of the LSRLL motif in both the cytoplasm-to-nucleus redistribution of MICoA and the transactivation function of ER. However, in spite of the presence of the LSRLL motif, MICoA did not sequester ER in the cytoplasm. This finding and the fact that E2 signaling is required to activate the MICoA suggest that E2 signaling either modifies the protein-protein interaction of MICoA via the LSRLL motif or alters MICoA’s conformation to favor its nuclear translocation. In addition, it is also possible that estradiol causes an effect to block a nuclear export process so that one disrupts the equilibrium between cytoplasm and nucleus results in MICoA being largely in the nucleus after exposure to E2. The by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from LXXLL motifs are important in mediating the protein-protein interactions between SRC1-3 and p300/CBP (18). It is also possible that the small amount of ER present in the cytoplasm is sufficient for the formation of the MICoA-ER complex upon E2 stimulation and MICoA subsequent translocation to the nucleus. Upon deletion of LSRLL motif MICoA lost its ER transactivation function indicating this motif is important for the said function. Alternatively, it is also possible that MICoA’s translocation to the nucleus is facilitated by the bound MTA1 and that MICoA needs the presence of MTA1 to act like a co-activator. Furthermore, MICoA could also act as an antagonist of a repressor function of MTA1 thereby functioning as a coactivator. Clearly, additional studies are needed to address these evolving questions. Our finding that the ER coactivator MICoA interacts with MTA1, an ER corepressor, is surprising, as it raises the possibility that the final outcome of the ER transactivation function is influenced by complex protein-protein interactions rather than by isolated interaction with one class of proteins. It has been proposed that different HDAC complexes such as mSin3 complex is recruited for simple deacetylation of dynamically regulated promoters, whereas NRD and CoREST-HDAC complexes are required to promoters that require stable repression (e.g. tissue specific silencing) or that are heritable states (44). The associated non-enzymatic activities may play a role in determining the nature of the repression. From our results, it appears that MTA1 has inhibitory activity against MICoA-mediated interaction with ER and stimulation of ER transactivation. A modest but significant reversal of MTA1-MICoA recruitment on one of the E2 target genes i.e. pS2 promoter was achieved by E2 stimulation of cells and was accompanied by the loss of HDAC2 interaction with MICoA-MTA1 complex (Fig 11). In addition, our results from the binding studies suggest that the LXXLL motif in MICoA is important for its binding to both MTA1 and ER(Fig 4 C, D and Fig 10 B). Since the presence of MTA1 influenced the by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from recruitment of MICoA to the ER target gene promoter (pS2 promoter), these results implied an ongoing potential competition between ER and MTA1 to interact with MICoA and thus, affecting the MICoA’s recruitment on ERE on the target gene promoter. We also found out that the ER association with MICoA is abrogated when MICoA interacts with MTA1 complex. Since MTA1 exhibited an overall corepressor function in the presence of MICoA and E2 stimulation, these findings suggested that HDAC2 association with MICoA might not constitute a major mechanism of MTA1-mediated corepression of MICoA-mediated ERE-activation. Modest but distinct withdrawal of MICoA from the pS2 promoter in presence of MTA1 and dismissal of ER from the complex could be the reason for MTA1’s corepressive function taking over the coactivator function of MICoA. Recently Nye et al. (2002) (57) have reported about the large sacle chromatin unfolding activity by estrogen receptor. Physiological significance of our findings is based on the observation of the MTA1 association of MICoA with the ER target gene promoter chromatin. Since the level of MTA1 is upregulated in breast cancer cells and by heregulin signaling (35), our current findings imply a potential suppression of the MICoA coactivatior function by pathologic level of MTA1 and suggest that these events may modulate the hormonal response in breast cancer cells. Particularly important is the ability of MICoA to further induce the transactivation of natural ER mutant (D351Y) found in tamoxifen resistant breast cancer cells. This finding suggests that MICoA is not only a potent coactivator of ER but may also be an important regulatory molecule in the context of breast cancer. MICoA could not further induce the asparatate at 351 position, when replaced by charge-less glycine. It is reported that D351G loses the ability to bind to coactivator because of charge less glycine (45). Such mutation could have interfered with binding of MICoA with the mutant ER. This further says that MICoA’s transactivation function of ER is probably by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from dependent upon its physical interaction with ER. In another instance MICoA could further induce the transactivation function of hypersensitive ER (K303R) in presence of E2. Similar finding was reported for p300 which has histone acetyl transferase activity of its own (43). This could be attributed to the HAT activity present in the MICoA complex on E2 signaling. MICoA’s interaction with hinge domain of ER might also be instrumental for such effect on K303R ER. In summary, the present study identified MICoA as a target of corepressor MTA1, established the coactivator function of MICoA, and provided new evidence to suggest that the transactivation functions of ER are influenced by the regulatory interactions between MICoA and MTA1. Our finding is in agreement with the emerging model involving coactivator and corepressor in the same complex, implying that MTA1 and MICoA might transmodulate functions of each other and that any potential deregulation of MTA1 is likely to contribute to the functional inactivation of ER pathway, presumably by derecruitment of MICoA from ER target promoter chromatin.